arylsulfatase D (ARSD) - coding DNA reference sequence

(used for mutation description)

(last modified June 1, 2010)


This file was created to facilitate the description of sequence variants in the ARSD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering ARSD transcript NM_001669.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5015
                                             ggaagccttggcacta       c.-61

 .         .         .         .         .         .                g.5075
 gcggcgcccgggcgcggagtgcgcagggcaaggtcctgcgctctgggccagcgctcggcc       c.-1

          .         .         .         .     | 02   .         .    g.8601
 ATGCGATCCGCCGCGCGGAGGGGACGCGCCGCGCCCGCCGCCAG | GGACTCTTTGCCGGTG    c.60
 M  R  S  A  A  R  R  G  R  A  A  P  A  A  R  |  D  S  L  P  V      p.20

          .         .         .         .         .         .       g.8661
 CTACTGTTTTTATGCTTGCTTCTGAAGACGTGTGAACCTAAAACTGCAAATGCCTTTAAA       c.120
 L  L  F  L  C  L  L  L  K  T  C  E  P  K  T  A  N  A  F  K         p.40

          .         .         .         .         .         .       g.8721
 CCAAATATCCTACTGATCATGGCGGATGATCTAGGCACTGGGGATCTCGGTTGCTACGGG       c.180
 P  N  I  L  L  I  M  A  D  D  L  G  T  G  D  L  G  C  Y  G         p.60

          .     | 03   .         .         .         .         .    g.12372
 AACAATACACTGAG | AACGCCGAATATTGACCAGCTTGCAGAGGAAGGTGTGAGGCTCACT    c.240
 N  N  T  L  R  |  T  P  N  I  D  Q  L  A  E  E  G  V  R  L  T      p.80

          .         .         .         .         .         .       g.12432
 CAGCACCTGGCGGCCGCCCCGCTCTGCACCCCAAGCCGAGCTGCATTCCTCACAGGGAGA       c.300
 Q  H  L  A  A  A  P  L  C  T  P  S  R  A  A  F  L  T  G  R         p.100

          .       | 04 .         .         .         .         .    g.13671
 CATTCCTTCAGATCAG | GCATGGACGCCAGCAATGGATACCGGGCCCTTCAGTGGAACGCA    c.360
 H  S  F  R  S  G |   M  D  A  S  N  G  Y  R  A  L  Q  W  N  A      p.120

          .         .         .         .         .         .       g.13731
 GGCTCAGGTGGACTCCCTGAGAACGAAACCACTTTTGCAAGAATCTTGCAGCAGCATGGC       c.420
 G  S  G  G  L  P  E  N  E  T  T  F  A  R  I  L  Q  Q  H  G         p.140

          .          | 05        .         .         .         .    g.16164
 TATGCAACCGGCCTCATAG | GAAAATGGCACCAGGGTGTGAATTGTGCATCCCGCGGGGAT    c.480
 Y  A  T  G  L  I  G |   K  W  H  Q  G  V  N  C  A  S  R  G  D      p.160

          .         .         .         .         .         .       g.16224
 CACTGCCACCACCCCCTGAACCACGGATTTGACTATTTCTACGGCATGCCCTTCACGCTC       c.540
 H  C  H  H  P  L  N  H  G  F  D  Y  F  Y  G  M  P  F  T  L         p.180

          .         .         .         .         .         .       g.16284
 ACAAACGACTGTGACCCAGGCAGGCCCCCCGAAGTGGACGCCGCCCTGAGGGCGCAGCTC       c.600
 T  N  D  C  D  P  G  R  P  P  E  V  D  A  A  L  R  A  Q  L         p.200

          .         .         .         .         .         .       g.16344
 TGGGGTTACACCCAGTTCCTGGCGCTGGGGATTCTCACCCTGGCTGCCGGCCAGACCTGC       c.660
 W  G  Y  T  Q  F  L  A  L  G  I  L  T  L  A  A  G  Q  T  C         p.220

          .         .         .         .         .         .       g.16404
 GGTTTCTTCTCTGTCTCCGCGAGAGCAGTCACCGGCATGGCCGGCGTGGGCTGCCTGTTT       c.720
 G  F  F  S  V  S  A  R  A  V  T  G  M  A  G  V  G  C  L  F         p.240

          .         .         .         .         .         .       g.16464
 TTCATCTCTTGGTACTCCTCCTTCGGGTTTGTGCGACGCTGGAACTGTATCCTGATGAGA       c.780
 F  I  S  W  Y  S  S  F  G  F  V  R  R  W  N  C  I  L  M  R         p.260

          .         .         .         .         .         .       g.16524
 AACCATGACGTCACGGAGCAACCCATGGTTCTGGAGAAAACAGCGAGTCTTATGCTAAAG       c.840
 N  H  D  V  T  E  Q  P  M  V  L  E  K  T  A  S  L  M  L  K         p.280

          .         .    | 06    .         .         .         .    g.18695
 GAAGCTGTTTCCTATATTGAAAG | ACACAAGCATGGGCCATTTCTCCTCTTCCTTTCTTTG    c.900
 E  A  V  S  Y  I  E  R  |  H  K  H  G  P  F  L  L  F  L  S  L      p.300

          .         .         .         .         .         .       g.18755
 CTGCATGTGCACATTCCCCTTGTGACCACGAGTGCATTCCTGGGGAAAAGTCAGCATGGC       c.960
 L  H  V  H  I  P  L  V  T  T  S  A  F  L  G  K  S  Q  H  G         p.320

          .         .         .         . | 07       .         .    g.23577
 TTATATGGTGATAATGTGGAGGAGATGGACTGGCTCATAG | GTAAGGTTCTTAATGCCATC    c.1020
 L  Y  G  D  N  V  E  E  M  D  W  L  I  G |   K  V  L  N  A  I      p.340

          .         .         .         .         .         .       g.23637
 GAAGACAATGGTTTAAAGAACTCAACATTCACGTATTTCACCTCTGACCATGGAGGACAT       c.1080
 E  D  N  G  L  K  N  S  T  F  T  Y  F  T  S  D  H  G  G  H         p.360

          .         .         .         .         .      | 08  .    g.24376
 TTAGAGGCAAGAGATGGACACAGCCAGTTAGGGGGATGGAACGGAATTTACAAAG | GTGGG    c.1140
 L  E  A  R  D  G  H  S  Q  L  G  G  W  N  G  I  Y  K  G |   G      p.380

          .         .         .         .         .         .       g.24436
 AAGGGCATGGGAGGATGGGAAGGTGGGATCCGCGTGCCCGGGATCTTCCACTGGCCGGGG       c.1200
 K  G  M  G  G  W  E  G  G  I  R  V  P  G  I  F  H  W  P  G         p.400

          .         .         .         .         .         .       g.24496
 GTGCTCCCGGCCGGCCGAGTGATTGGAGAGCCCACGAGCCTGATGGACGTGTTCCCTACT       c.1260
 V  L  P  A  G  R  V  I  G  E  P  T  S  L  M  D  V  F  P  T         p.420

          .         .         .         | 09         .         .    g.25530
 GTGGTCCAGCTGGTGGGTGGCGAGGTGCCCCAGGACAG | GGTGATTGATGGCCACAGCCTG    c.1320
 V  V  Q  L  V  G  G  E  V  P  Q  D  R  |  V  I  D  G  H  S  L      p.440

          .         .         .         .         .         .       g.25590
 GTACCCTTGCTGCAGGGAGCTGAGGCACGCTCGGCACATGAGTTCCTGTTTCATTACTGT       c.1380
 V  P  L  L  Q  G  A  E  A  R  S  A  H  E  F  L  F  H  Y  C         p.460

          .         .         .         . | 10       .         .    g.26738
 GGGCAGCATCTTCACGCAGCACGCTGGCACCAGAAGGACA | GTGGAAGCGTCTGGAAGGTT    c.1440
 G  Q  H  L  H  A  A  R  W  H  Q  K  D  S |   G  S  V  W  K  V      p.480

          .         .         .         .         .         .       g.26798
 CATTACACGACCCCGCAGTTCCACCCCGAGGGAGCGGGGGCCTGCTACGGCCGAGGCGTC       c.1500
 H  Y  T  T  P  Q  F  H  P  E  G  A  G  A  C  Y  G  R  G  V         p.500

          .         .         .         .         .         .       g.26858
 TGCCCATGCTCCGGGGAGGGCGTGACCCATCACAGACCCCCTTTGCTCTTTGACCTCTCC       c.1560
 C  P  C  S  G  E  G  V  T  H  H  R  P  P  L  L  F  D  L  S         p.520

          .         .         .         .         .         .       g.26918
 AGGGACCCCTCCGAGGCACGGCCCCTGACCCCCGACTCCGAGCCCCTGTACCACGCCGTG       c.1620
 R  D  P  S  E  A  R  P  L  T  P  D  S  E  P  L  Y  H  A  V         p.540

          .         .         .         .         .         .       g.26978
 ATAGCAAGGGTAGGTGCCGCGGTGTCGGAGCATCGGCAGACCCTGAGTCCTGTGCCCCAG       c.1680
 I  A  R  V  G  A  A  V  S  E  H  R  Q  T  L  S  P  V  P  Q         p.560

          .         .         .         .         .         .       g.27038
 CAGTTTTCCATGAGCAACATCCTGTGGAAGCCGTGGCTGCAGCCGTGCTGCGGACATTTC       c.1740
 Q  F  S  M  S  N  I  L  W  K  P  W  L  Q  P  C  C  G  H  F         p.580

          .         .         .         .                           g.27080
 CCGTTCTGTTCATGCCACGAGGATGGGGATGGCACCCCCTGA                         c.1782
 P  F  C  S  C  H  E  D  G  D  G  T  P  X                           p.593

          .         .         .         .         .         .       g.27140
 atgccaggactgtgagagaggatccaggagagcctgactgcgttgcaaacaaaattctcc       c.*60

          .         .         .         .         .         .       g.27200
 aagcttggttctatcttcagcttccctttttgcaaggaacatgccctggactgagagtgg       c.*120

          .         .         .         .         .         .       g.27260
 gtccccactttctttctttctttctttcttttttgagacagagtgtcgctctgtccctca       c.*180

          .         .         .         .         .         .       g.27320
 ggctggaatgcaatggcacgatctctgctcactgcaacctccgcctcccgggttcaagcg       c.*240

          .         .         .         .         .         .       g.27380
 attttcctgcctcagcctcctgagtacccaggattacaggcaccaggcacctgccaccat       c.*300

          .         .         .         .         .         .       g.27440
 gcctagctaatttttgtagttttagtagagacagggtttcaccatgttgcccaggctggt       c.*360

          .         .         .         .         .         .       g.27500
 ctcgcactcctgacctcaagtcatccacctgcctcagcctcccaaagtgctgggattaca       c.*420

          .         .         .         .         .         .       g.27560
 ggcacgagccactgcgcccatgtagggtttccctttcctgatttgtgaaataagactgtc       c.*480

          .         .         .         .         .         .       g.27620
 ccagtaggcacccactgatgcctcctcttcctcttctaaatctcagggttcgtcattgtg       c.*540

          .         .         .         .         .         .       g.27680
 ccaatgcccgatgttttcacccctccgtcttaaagcattgttgcaatttcatcacctaga       c.*600

          .         .         .         .         .         .       g.27740
 tgacataacagccttacaaaaggacagggaggagtgtctgttcctactctcacatagcgg       c.*660

          .         .         .         .         .         .       g.27800
 aggaaagttagagcctctcagtctctgtttatgaggactcattaatctcaaataattgat       c.*720

          .         .         .         .         .         .       g.27860
 gcatttttcatacattagggtctctgtccatgtgtcttcctgatattgttatagaaatgg       c.*780

          .         .         .         .         .         .       g.27920
 cttcaggctgctggtaacagatgctgcggaaaaagaatgccttaaacaaagccaggcacg       c.*840

          .         .         .         .         .         .       g.27980
 gtgactcacacctgtaatcccagcactttgggaggctaaggtgggaggatcacttgagcc       c.*900

          .         .         .         .         .         .       g.28040
 taggagttagacacctacccagcctgagcaacacagtgagacctcatctctacaaaaaac       c.*960

          .         .         .         .         .         .       g.28100
 aaataattagctagatgtcgtggcgcacagctgtagtctcagctacttaggaggctgagg       c.*1020

          .         .         .         .         .         .       g.28160
 cgggaggattatttgagcctgggaggtcaaaactgcaatgagctaagattgcactactgc       c.*1080

          .         .         .         .         .         .       g.28220
 actccgggctgggagacagagtaagaccctgccttaaaaaaaaaaaaaaaaaaatgcctt       c.*1140

          .         .         .         .         .         .       g.28280
 aaagaaaataataagagaagggtgtgttctcttccaagtaatgagccgatcaaggggaag       c.*1200

          .         .         .         .         .         .       g.28340
 caacccaaggctagcaggctcttttcaattcccagctctgccactcttagcatggcagag       c.*1260

          .         .         .         .         .         .       g.28400
 agttggcctcattatgccagtatggctgccacagtgtcagacatcacattccaggcagtg       c.*1320

          .         .         .         .         .         .       g.28460
 gaaaggagaaagaaccaaagggcatccctttctcttgaagcagtccctgtgaggggggat       c.*1380

          .         .         .         .         .         .       g.28520
 tatctggaagccccaacccaatttctgcttccaaccattatccatagaaacaactggaag       c.*1440

          .         .         .         .         .         .       g.28580
 ttgagaagtgcagtcttttaggtgggcacctggctgccctgtatgaaaccagaattaggt       c.*1500

          .         .         .         .         .         .       g.28640
 tggtcagcaggaaaacaagaaaacacttactgtgttgactgaggtttttgacgcatcgct       c.*1560

          .         .         .         .         .         .       g.28700
 ttattgtcaaattaaacaactctatctcattctgcactgaaacacgtactaccattgcct       c.*1620

          .         .         .         .         .         .       g.28760
 ataattggaaaatgatcctcagaggcacagaagatgccctgatggaaagtttgccccttg       c.*1680

          .         .         .         .         .         .       g.28820
 ggcaaagagacagccatgggaaccttcagacatagagagagaaggtggcttttctcccta       c.*1740

          .         .         .         .         .         .       g.28880
 cattcctcaaatagctaagatttggccagtgtgttttctaagtcaattctagtgtgtttc       c.*1800

          .         .         .         .         .         .       g.28940
 atcctcacctcttccctctgtggctttgatgatggaagtgtagtcctaacctactgcaca       c.*1860

          .         .         .         .         .         .       g.29000
 gctgggaccccctgcccctagatcccaatactggggatgggaggaccttgcactattccc       c.*1920

          .         .         .         .         .         .       g.29060
 ctcagtccatctatcgaggtctttgcaggaagcatactgggaattgaaacgagagcctaa       c.*1980

          .         .         .         .         .         .       g.29120
 atgacatctaagaaaggcagtgttcaataccaggtattaggtgaggatgggattctaagg       c.*2040

          .         .         .         .         .         .       g.29180
 acatcagtgggaggcagggagccaccttcagacctcagcatggaagcttccaagatccag       c.*2100

          .         .         .         .         .         .       g.29240
 aggaagaggcaacagcactgagagtcataggtagaagaatcatcacagccctgctaacca       c.*2160

          .         .         .         .         .         .       g.29300
 ggcagctgatgcccctctcccctggctccctgtgtccaaatcctacaggggcatctgttg       c.*2220

          .         .         .         .         .         .       g.29360
 gctgaactcaacctgaagccaaagagaagatgagtggagagaggcaacatttatagagct       c.*2280

          .         .         .         .         .         .       g.29420
 caggtttctagggctggagagggatctggagggacacacaggagacacctggcataacca       c.*2340

          .         .         .         .         .         .       g.29480
 aaaaatgattaaaaaaaaaaaaaaaaagaaacatctatggagcatgggacacggggagtg       c.*2400

          .         .         .         .         .         .       g.29540
 gaggcagctaaaagccatctcatctttcaccgtattcaacaagcccattataacaagtct       c.*2460

          .         .         .         .         .         .       g.29600
 ttcacgctcaaccattcaaacaatcccaacaatcccagcctaagaatttcctggcatttg       c.*2520

          .         .         .         .         .         .       g.29660
 atgaaaatggctgtgggttttgctatctttaagctccctgggaagcaggatataagccca       c.*2580

          .         .         .         .         .         .       g.29720
 gggctggcaggctctttctagctacctgctcttgcacatagagtttgcctcatggttgca       c.*2640

          .         .         .         .         .         .       g.29780
 agaaggctgccatagctccagatggcacatagacattccaggcagcaggaaaaaggaagg       c.*2700

          .         .         .         .         .         .       g.29840
 agcacttaaccgaaggaggtcagggagttggttagtctccacctgaagaagagagccatg       c.*2760

          .         .         .         .         .         .       g.29900
 aaccagcttcagttgactaacgggctcctgtgagtgcatctttggacttttctggaggtt       c.*2820

          .         .         .         .         .         .       g.29960
 gaaatctagatgtggtatgtgtcttaaagcagccaccaactcctcccattaccttccaag       c.*2880

          .         .         .         .         .         .       g.30020
 tgagcccaactacacgatggagcctcttccctgcccttggatctgggctgagcctctgac       c.*2940

          .         .         .         .         .         .       g.30080
 ttgcgttgaccaacagaatgcagtgaaagtgatgccgatactaccctccctgccctagac       c.*3000

          .         .         .         .         .         .       g.30140
 ttgggatacctggcagctatattcttccattcctcaggacttgcaaaaacgggtctcagc       c.*3060

          .         .         .         .         .         .       g.30200
 atgccttcccagagccatgaggtgtttctttgcccattcattgatctgagaagtgagtgt       c.*3120

          .         .         .         .         .         .       g.30260
 aaggagtttaaatcaacctctgttctgtgctagttaaggtaataaagttgctgcagtcca       c.*3180

          .         .         .         .         .         .       g.30320
 gggggtaggtacctgtggacggctctgcgaataggacagttgcatttcttgggaatcaag       c.*3240

          .         .         .         .         .         .       g.30380
 tgcatccctaggctggcagtgcagcagaaatactgaataaaatgtgacaaatctccctgg       c.*3300

                                                                    g.30381
 a                                                                  c.*3301

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Arylsulfatase D protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 26
©2004-2010 Leiden University Medical Center